zeb2b

Ensembl ID:
ENSDARG00000078416
ZFIN ID:
ZDB-GENE-080717-1
Description:
SIP1b [Source:UniProtKB/TrEMBL;Acc:B0LVF0]
Human Orthologue:
ZEB2
Human Description:
zinc finger E-box binding homeobox 2 [Source:HGNC Symbol;Acc:14881]
Mouse Orthologue:
Zeb2
Mouse Description:
zinc finger E-box binding homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1344407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17937 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090019 Nonsense 772 1194 6 9
Genomic Location (Zv9):
Chromosome 6 (position 926756)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 1165222
GRCz11 6 858489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATAAGATGGACCACTCCCGGAGCAACACGCCCTCTCCTCTGAACTTAT[C/A]GTCCGCCTCRTCCAAAAATTCCMACACTAGCTCTTAYACGCCCAACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link