zgc:173990

Ensembl ID:
ENSDARG00000078394
ZFIN ID:
ZDB-GENE-080218-1
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8KBR6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21710 Nonsense Mutation detected in F1 DNA During 2018
sa34880 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058425 Nonsense 273 432 1 1
Genomic Location (Zv9):
Chromosome 10 (position 19599703)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19612049
GRCz11 10 19569483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATTCAACAAGCCAGGTTGTTTATGAATCTTCAACCCCATATGTATA[T/A]TTATCATCGCCCCAAGTTGTTACTAGTCAGTTGACACCTGTGTCAGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058425 Nonsense 396 432 1 1
Genomic Location (Zv9):
Chromosome 10 (position 19600070)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 19612416
GRCz11 10 19569850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGGTTGTTTCAGAACCTTCAACCCCGTATGTATCTGTATCATTGCCA[C/T]AAGTTGTAACTAGTCAGACGTATAAAGTGCCAAGTTCGAAGCAGGTAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link