
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam98a
- Ensembl ID:
- ENSDARG00000078391
- ZFIN ID:
- ZDB-GENE-091202-6
- Human Orthologue:
- FAM98A
- Human Description:
- family with sequence similarity 98, member A [Source:HGNC Symbol;Acc:24520]
- Mouse Orthologue:
- Fam98a
- Mouse Description:
- family with sequence similarity 98, member A Gene [Source:MGI Symbol;Acc:MGI:1919972]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42921 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42921
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102763 | Nonsense | 446 | 497 | 8 | 9 |
ENSDART00000126525 | None | 305 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 17 (position 23042808)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 23192957 GRCz11 17 23212981 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAAGGACCTGGCTACCAAGGTGGAGGAGGAGGAGGAGGCTACCAGGGC[G/T]GAGGTGGCGGTTACCAGCACGAGGGCTACTATCAGGACGGAGGACGACAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hypertension (young onset): Genome-wide association study of young-onset hypertension in the Han Chinese population of Taiwan. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: