slco1f2

Ensembl ID:
ENSDARG00000078354
ZFIN ID:
ZDB-GENE-080305-3
Description:
solute carrier organic anion transporter family, member 1F2 [Source:RefSeq peptide;Acc:NP_001121745
Human Orthologue:
SLCO1C1
Human Description:
solute carrier organic anion transporter family, member 1C1 [Source:HGNC Symbol;Acc:13819]
Mouse Orthologue:
Slco1c1
Mouse Description:
solute carrier organic anion transporter family, member 1c1 Gene [Source:MGI Symbol;Acc:MGI:1889679]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30492 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30493 Nonsense Mutation detected in F1 DNA During 2018
sa38231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Essential Splice Site 149 606 4 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 134386)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75910982
GRCz11 4 77296236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACATGCTCATCCGACTCTCAGAAAACTCTTCAACAGCCTTTTTCTGG[T/A]AATGCGTTATGTGTAGAAAAGCATAGGAGTTATTTGTTTAATGCAATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Nonsense 335 606 8 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 138410)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75906958
GRCz11 4 77292128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCGTACAGTATAGTGGCATTCAACGACTTCGCCATACTTGTAACGTA[C/A]ACGCCAAAGTATCTGGAACAGCAGTTTGGGCAAAGCGCATCCAAAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051754 Nonsense 520 606 11 14
Genomic Location (Zv9):
Chromosome Zv9_NA995 (position 139223)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75906145
GRCz11 4 77291315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCCAACTGCAACAGAATGATGTACCTTTATCTGGGATTGCAGTCTT[T/A]GGCCCTCTTTGTGTACAGTCTTGGTGCTGTTCCCCTTTTCACCATGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link