
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sec22a
- Ensembl ID:
- ENSDARG00000078328
- ZFIN ID:
- ZDB-GENE-030131-3553
- Description:
- vesicle-trafficking protein SEC22a [Source:RefSeq peptide;Acc:NP_955992]
- Human Orthologue:
- SEC22A
- Human Description:
- SEC22 vesicle trafficking protein homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:20260]
- Mouse Orthologue:
- Sec22a
- Mouse Description:
- SEC22 vesicle trafficking protein homologe A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2447876
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21543 | Nonsense | Available for shipment | Available now |
sa21544 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21543
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082165 | Nonsense | 29 | 303 | 2 | 7 |
ENSDART00000109110 | Nonsense | 29 | 303 | 1 | 6 |
ENSDART00000133643 | Nonsense | 29 | 205 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 38903442)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 38041338 GRCz11 9 37851133 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGGGACGGTTTGCCTCTCTCAGCCTCCACAGACTATGAACTGGATAAA[G/T]GAATTCAGGAGACAAAGAAACATCTCAAGGTCCTGTCCAAAAAACTCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21544
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000082165 | Nonsense | 87 | 303 | 3 | 7 |
ENSDART00000109110 | Nonsense | 87 | 303 | 2 | 6 |
ENSDART00000133643 | Nonsense | 87 | 205 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 38906254)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 38044150 GRCz11 9 37853945 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTGATGGTTTGCACAGAGAACTATCCCAATGTCCTGGCCTTCAGCTTCT[T/G]AGATGAGCTTCAGAGAGAGTTCATAGTCACGTATGACACCAAGCGGATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: