
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-175m17.7
- Ensembl ID:
- ENSDARG00000078317
- ZFIN ID:
- ZDB-GENE-091204-18
- Human Orthologue:
- DUSP10
- Human Description:
- dual specificity phosphatase 10 [Source:HGNC Symbol;Acc:3065]
- Mouse Orthologue:
- Dusp10
- Mouse Description:
- dual specificity phosphatase 10 Gene [Source:MGI Symbol;Acc:MGI:1927070]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43659 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23954 | Nonsense | Available for shipment | Available now |
sa7482 | Missense | Mutation detected in F1 DNA | During 2018 |
sa1705 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa43659
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109626 | Nonsense | 215 | 904 | 1 | 3 |
ENSDART00000139058 | Nonsense | 215 | 892 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26678090)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 27247001 GRCz11 21 27283696 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACAGTATCTCCTGGAGGAATATTGGAGTTTGTACCAGCTCAAAGACAG[C/T]AGTCAAAATCCAAACCAACAAGAGAGAGAGACTTGTCATCAAAGACTTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23954
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109626 | Nonsense | 319 | 904 | 1 | 3 |
ENSDART00000139058 | Nonsense | 319 | 892 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26678402)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 27247313 GRCz11 21 27284008 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAGCACATCAGTCAGCCCCGTTCGTCACGAATTAGAGAACATCGGCCA[C/T]AAATTCTTCACGCCTTGCCTCTCTCACCTACATCTTCCCGGGGAGGCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7482
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109626 | Missense | 417 | 904 | 1 | 3 |
ENSDART00000139058 | Missense | 417 | 892 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26678698)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 27247609 GRCz11 21 27284304 - KASP Assay ID:
- 554-4093.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAGGGTGTCTATCTACTGCTTCCACCACCAACACCTCCTCTTCCAATAG[C/A]ACTGTCTCAGATTGTCGTACAGGACTGCTTAGACCATTAGGTTGTGCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1705
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109626 | Nonsense | 808 | 904 | 2 | 3 |
ENSDART00000139058 | Nonsense | 796 | 892 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 26680469)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 27249380 GRCz11 21 27286075 - KASP Assay ID:
- 554-1651.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACAAAAGRCTCCCCGCTACTGACAACAGCAAGCAGAACCTGCGACAGTA[T/A]TTCGAAGAGGTTTTTGAGTTTATAGGTAAGAGAACGTGTCAACTTTTGTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: