ENSDARG00000078306

Ensembl ID:
ENSDARG00000078306
Human Orthologues:
RNF126, RNF126P1
Human Descriptions:
ring finger protein 126 pseudogene 1 [Source:HGNC Symbol;Acc:30340]
ring finger protein 126 [Source:HGNC Symbol;Acc:21151]
Mouse Orthologue:
Rnf126
Mouse Description:
ring finger protein 126 Gene [Source:MGI Symbol;Acc:MGI:1917544]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45122 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115038 Essential Splice Site 25 143 1 4
Genomic Location (Zv9):
Chromosome 2 (position 55415411)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 55112310
GRCz11 2 54845239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGTTCTTCTGTCACCGGTGCTCGGAAGAAATCAGCCCTCGGCTCCCG[G/T]TAAGTCCTAGCGGTCTGAACAAGCCTCTGCCGCAGGCATTGAATCAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link