si:dkey-226b20.7

Ensembl ID:
ENSDARG00000078285
ZFIN ID:
ZDB-GENE-090313-250
Description:
Novel protein similar to vertebrate inositide-3-kinase adaptor protein 1 (PIK3AP1) [Source:UniProtKB
Human Orthologue:
PIK3AP1
Human Description:
phosphoinositide-3-kinase adaptor protein 1 [Source:HGNC Symbol;Acc:30034]
Mouse Orthologue:
Pik3ap1
Mouse Description:
phosphoinositide-3-kinase adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:1933177]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38935 Nonsense Mutation detected in F1 DNA During 2018
sa16590 Nonsense Available for shipment Available now
sa42191 Nonsense Mutation detected in F1 DNA During 2018
sa42192 Nonsense Mutation detected in F1 DNA During 2018
sa10642 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 264 837 4 16
ENSDART00000144020   None 237 None 6
ENSDART00000148034 Nonsense 263 464 4 7
Genomic Location (Zv9):
Chromosome 13 (position 23253942)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983280
GRCz11 13 23113730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATGATTTGTTTTTCTCTTTTAGATATGCCAGCTGGGGAAGTATCAT[T/A]GACGGTTTATAAAAATCAGTCTGTGTTATGCTCATCAACTGTAACATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 299 837 4 16
ENSDART00000144020   None 237 None 6
ENSDART00000148034 Nonsense 298 464 4 7
Genomic Location (Zv9):
Chromosome 13 (position 23254046)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983384
GRCz11 13 23113834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAATGGAGGAAAKTTGCAGATATCTAAAGAAAGCAACTGATCCAGTG[C/T]AGWTCAWGTGTCAGGTAAWAGCATGAAACAAAYAAAYAGTTGATAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 315 837 5 16
ENSDART00000144020   None 237 None 6
ENSDART00000148034 Nonsense 314 464 5 7
Genomic Location (Zv9):
Chromosome 13 (position 23254538)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22983876
GRCz11 13 23114326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATTATATTTTCAGGCATTTGATATCACATCAAAGCTCCAAGAGTCGT[T/A]AGATAATTTGCTTGCTACCTCTCTTGAAGAACGGATGCCTGTAAATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 435 837 7 16
ENSDART00000144020   None 237 None 6
ENSDART00000148034 Nonsense 434 464 7 7
Genomic Location (Zv9):
Chromosome 13 (position 23255816)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22985154
GRCz11 13 23115604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACGCACATTGAGGAATCTCAGAACGCCCCCGAAAGTGAGGACATCTA[T/A]GAGGATATGCTGAGAGCTTCCCAGAACTTCATCTCTGAGTTCGATAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110266 Nonsense 825 837 16 16
ENSDART00000144020 Nonsense 225 237 6 6
ENSDART00000148034   None 464 None 7
Genomic Location (Zv9):
Chromosome 13 (position 23268189)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22997527
GRCz11 13 23127977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTTAYGTATCCAATCCATCCCGCCCTGTTCCTCAGAATCCTGCACAA[A/T]GAYCTATACCACCTCCGCCGGTACCCAGACGGACATGGTGARGGTCTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link