zgc:194398

Ensembl ID:
ENSDARG00000078250
ZFIN ID:
ZDB-GENE-081022-111
Description:
hypothetical protein LOC100189615 [Source:RefSeq peptide;Acc:NP_001128614]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33710 Nonsense Mutation detected in F1 DNA During 2018
sa11470 Nonsense Available for shipment Available now
sa11658 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110377 Nonsense 96 867 1 1
Genomic Location (Zv9):
Chromosome 5 (position 52788541)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50455737
GRCz11 5 51102330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAGAGGAAATCATAGATGAGCATGTGCAAGAAGCTGTAAAATCTGGA[G/T]AGCATTCAGAAGCAACAACAATGGCAGCGGACACAAATATTCAGGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110377 Nonsense 327 867 1 1
Genomic Location (Zv9):
Chromosome 5 (position 52789234)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50456430
GRCz11 5 51103023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATACAAGCAGAAATGAAGATGATTCATTGAYYACAATAGAAACTGTA[C/T]GAAGTAAAACAGTAGAGACYAATGCTGAACTTCTAAATGTATATGGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11658
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110377 Nonsense 484 867 1 1
Genomic Location (Zv9):
Chromosome 5 (position 52789705)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50456901
GRCz11 5 51103494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAARSACAGATCAGGAAACAWCCTTAAYTACGAGAAGAAGTCTCAGGTCC[C/T]GAACAGTAACAGTCCAATCTACACCAGGAAGAACGCCAAAACGGCTCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link