ZCCHC3

Ensembl ID:
ENSDARG00000078237
Description:
zinc finger, CCHC domain containing 3 [Source:HGNC Symbol;Acc:16230]
Human Orthologue:
ZCCHC3
Human Description:
zinc finger, CCHC domain containing 3 [Source:HGNC Symbol;Acc:16230]
Mouse Orthologue:
Zcchc3
Mouse Description:
zinc finger, CCHC domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1915167]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39789 Nonsense Mutation detected in F1 DNA During 2018
sa19699 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39789
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114291 Nonsense 19 149 2 2
Genomic Location (Zv9):
Chromosome 2 (position 14588531)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15099358
GRCz11 2 14767948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCTCACTGTCCACATGTACAATCCTTTTGTGGAAGATGGCGATGTTT[T/A]AACCTTTTTGGCCAGGTACTGTGATTCTGTGAAGGGAGGAGAGCGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114291 Nonsense 112 149 2 2
Genomic Location (Zv9):
Chromosome 2 (position 14588809)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 15099636
GRCz11 2 14768226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTAAAGGCGGACTGTGTGGGCCAGTGGTGCCGTCATTGTGGATCGGCT[G/T]AGCATGAGGCCTCTGGCTGTCCAGAACCAAAGACCTGTAGCCTGTGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link