si:dkey-253d23.12

Ensembl ID:
ENSDARG00000078234
ZFIN ID:
ZDB-GENE-070912-478
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S6L3]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37433 Nonsense Mutation detected in F1 DNA During 2018
sa29724 Missense, Nonsense Mutation detected in F1 DNA During 2018
sa45754 Nonsense Mutation detected in F1 DNA During 2018
sa3172 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026   None 887 None 11
ENSDART00000146598 Nonsense 151 790 5 7
Genomic Location (Zv9):
Chromosome 22 (position 10078496)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9938664
GRCz11 22 9968346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTCACAGGAAACACAAGGGGTTTCAAGACGGTCTTCTGGGGATCTTT[C/T]AGGTATAAGTAAAAGACATACATTTGTTGTAATTTTTGTGTTAAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Missense 249 887 2 11
ENSDART00000146598 Nonsense 559 790 7 7
Genomic Location (Zv9):
Chromosome 22 (position 10076754)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9936922
GRCz11 22 9966604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACACAGATGTACACACACTTTCTGCGCTTTCAGATCCAGCAGAGCAGA[C/T]GAAAGTATAATGGAGAATACACACCAGATGTGTCCTGGGATAAAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Nonsense 489 887 4 11
ENSDART00000146598   None 789 None 7
Genomic Location (Zv9):
Chromosome 22 (position 10075977)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9936145
GRCz11 22 9965827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATTCCATAAATCAGACGAGTGTCTCATCAGACTATCAGCAGTCATC[A/T]AAACCTGCAAAAGAGCTCTGTAAGTCCATGAATACAAAGTAAAATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106026 Essential Splice Site 714 887 9 11
ENSDART00000146598   None 790 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 10064900)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9925068
GRCz11 22 9954750
KASP Assay ID:
554-2870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACATATCAACATGTATCTCAGTCATTGTCTTTTCGCTTTCTATCTTC[A/T]GACTTTGTAAATGCAGTATTACAGAGGAACAGTGTGTGATCCTGACTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link