si:dkeyp-68h1.1

Ensembl ID:
ENSDARG00000078226
ZFIN ID:
ZDB-GENE-070912-673
Description:
cadherin-12 [Source:RefSeq peptide;Acc:NP_001153302]
Human Orthologue:
CDH12
Human Description:
cadherin 12, type 2 (N-cadherin 2) [Source:HGNC Symbol;Acc:1751]
Mouse Orthologue:
Cdh12
Mouse Description:
cadherin 12 Gene [Source:MGI Symbol;Acc:MGI:109503]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7500 Missense Mutation detected in F1 DNA During 2018
sa32932 Essential Splice Site Available for shipment Available now
sa19782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087446 Missense 190 800 3 11
ENSDART00000138733 Missense 190 800 4 12
Genomic Location (Zv9):
Chromosome 2 (position 28752186)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29053821
GRCz11 2 29037354
KASP Assay ID:
554-4203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTRTGATCAGGCACATATGTGACACAAATAACCGCCACTGAYRCTGATG[A/T]CCCTACTTATGGAAACMGTGCACGGATTGTGTACAGCATCCTTCATGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087446 Essential Splice Site 544 800 9 11
ENSDART00000138733 Essential Splice Site 544 800 10 12
Genomic Location (Zv9):
Chromosome 2 (position 28822188)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29123823
GRCz11 2 29107356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCTTCACAGACCAGGAACAGAAACTTTACCATCAGGGACTATGGAAG[T/C]AAGTTAGAGAGTTTTAGAGAAAATATAAATATACTAAATAACCTAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087446 Nonsense 659 800 11 11
ENSDART00000138733 Nonsense 659 800 12 12
Genomic Location (Zv9):
Chromosome 2 (position 28831298)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29132933
GRCz11 2 29116466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCTGATGTCGTCTAAAGAGGACGTCAGGGACAATGTGATCCACTA[T/A]GATGATGAGGGGGGCGGGGAAGAGGACACCCAGGCCTTCGACATAGGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link