ZNF580

Ensembl ID:
ENSDARG00000078220
Description:
zinc finger protein 580 [Source:HGNC Symbol;Acc:29473]
Human Orthologues:
ZNF524, ZNF580, ZNF581
Human Descriptions:
zinc finger protein 524 [Source:HGNC Symbol;Acc:28322]
zinc finger protein 580 [Source:HGNC Symbol;Acc:29473]
zinc finger protein 581 [Source:HGNC Symbol;Acc:25017]
Mouse Orthologues:
Zfp524, Zfp580
Mouse Descriptions:
zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]
zinc finger protein 580 Gene [Source:MGI Symbol;Acc:MGI:1916242]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12449 Nonsense Available for shipment Available now
sa28605 Nonsense Mutation detected in F1 DNA During 2018
sa12651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110785 Nonsense 153 886 1 1
Genomic Location (Zv9):
Chromosome 16 (position 15310546)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13669005
GRCz11 16 13559125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACATTGTTAACACCTCAANNNATGATTTTCTAGAGGTTAAGGTTCAA[C/T]GACAATCTGTTCTGAATAAAGATTTTCATAATGACAAGCTAGTGTCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110785 Nonsense 556 886 1 1
Genomic Location (Zv9):
Chromosome 16 (position 15309336)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13667795
GRCz11 16 13557915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGCCTCTTCCACTGTTGCACTTCCCTTAGCCACGTGTCCCCTTGATT[T/A]GGGATCTACATTAATTTCACATCCGTCACTTCTCAGCCTCAGCACGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110785 Nonsense 756 886 1 1
Genomic Location (Zv9):
Chromosome 16 (position 15308737)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13667196
GRCz11 16 13557316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTGAGCGCCATTCCATCACACACTCCCAAAGCAAACCCCATGTGTGT[C/T]AACTCTGTGGCAAGGCATTCAAAAGATCAAGCCATCTTGAGCGACACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link