zgc:172162

Ensembl ID:
ENSDARG00000078217
ZFIN IDs:
ZDB-GENE-080220-20, ZDB-GENE-080220-20
Description:
hypothetical protein LOC565383 [Source:RefSeq peptide;Acc:NP_001121724]
Human Orthologue:
CBLC
Human Description:
Cas-Br-M (murine) ecotropic retroviral transforming sequence c [Source:HGNC Symbol;Acc:15961]
Mouse Orthologue:
Cblc
Mouse Description:
Casitas B-lineage lymphoma c Gene [Source:MGI Symbol;Acc:MGI:1931457]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2841 Nonsense F2 line generated During 2018
sa22849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2841
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019852 Nonsense 255 499 4 10
ENSDART00000110619 Nonsense 255 499 4 11
Genomic Location (Zv9):
Chromosome 16 (position 28014082)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25859769
GRCz11 16 25774801
KASP Assay ID:
554-2581.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATTTGGCAGTAACTCATCCTGGATATATGGCTTTTCTCACCTATGAC[C/T]AGGTCAAGGCTCGACTGGAGCACTACAGACATCGTCCCGGCAGGTGAGAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019852 Nonsense 358 499 7 10
ENSDART00000110619 Nonsense 358 499 7 11
Genomic Location (Zv9):
Chromosome 16 (position 28017840)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25863527
GRCz11 16 25778559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTCAGGAGCAGTATGAATTATATTGTGAGATTGGTAGCACGTTT[C/T]AGCTCTGCAAAATCTGCACCGAACGAGACAAAGACACTCGCATTCAGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link