zgc:171506

Ensembl ID:
ENSDARG00000078206
ZFIN ID:
ZDB-GENE-080204-96
Description:
hypothetical protein LOC792896 [Source:RefSeq peptide;Acc:NP_001107920]
Human Orthologue:
DEAF1
Human Description:
deformed epidermal autoregulatory factor 1 (Drosophila) [Source:HGNC Symbol;Acc:14677]
Mouse Orthologue:
Deaf1
Mouse Description:
deformed epidermal autoregulatory factor 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1858496]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40061 Nonsense Mutation detected in F1 DNA During 2018
sa20001 Nonsense Available for shipment Available now
sa33166 Essential Splice Site Mutation detected in F1 DNA During 2018
sa26059 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111997 Nonsense 21 269 2 8
Genomic Location (Zv9):
Chromosome 3 (position 24910251)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24488462
GRCz11 3 24619010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCGATAGCTATGATGAAATGGAAGGTGGACGAAGGAAAATGCCTGAA[C/T]GATTGTGCAAAAAGGGACCTGCCAAGGGTAATTGAGCTCTCCAAATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111997 Nonsense 107 269 4 8
Genomic Location (Zv9):
Chromosome 3 (position 24912030)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24490241
GRCz11 3 24620789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGTCACTTGTGGGGAAAAGGAAGGCATCCTGTGTTTGCGCAAATA[T/A]AATAATGGTAGGTGACAAACTTGTTACAGGATACATGTGTGTTTAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111997 Essential Splice Site 154 269 5 8
Genomic Location (Zv9):
Chromosome 3 (position 24912295)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24490506
GRCz11 3 24621054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGATCAGCATCTTTTATCATAAAATTCCACTTCAGACATTCATAGAG[G/A]TGAATAGAACTGTTTCGTTACTAATCAGTACTACCCTTTATTAATCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111997 Nonsense 213 269 8 8
Genomic Location (Zv9):
Chromosome 3 (position 24918521)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24496732
GRCz11 3 24627280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTGCTGGATCTTCTGACATAGAGGAGGCTGATCAGACTAGTGAAGAA[C/T]AAGAAGCAGCAGCAGCAGATCCAATGAGTGAATGCCAGAACCCTATAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link