zgc:77058

Ensembl ID:
ENSDARG00000078202
ZFIN ID:
ZDB-GENE-040426-2507
Description:
UPF0461 protein C5orf24 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NXA8]
Human Orthologue:
C5orf24
Human Description:
chromosome 5 open reading frame 24 [Source:HGNC Symbol;Acc:26746]
Mouse Orthologue:
B230219D22Rik
Mouse Description:
RIKEN cDNA B230219D22 gene Gene [Source:MGI Symbol;Acc:MGI:1925771]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43731 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105201 Nonsense 108 268 1 2
Genomic Location (Zv9):
Chromosome 21 (position 44376963)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45571477
GRCz11 21 45736207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACCAACAAGAGCTCCGATTCCAAGAAGAAGGCGGCGTCAGGGCGGT[C/A]AGGGAAGCGTGGCCGGCCCACAGGGACCACCAAACTTGCCGGATACAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link