
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gdpd4a
- Ensembl ID:
- ENSDARG00000078196
- ZFIN ID:
- ZDB-GENE-091204-436
- Human Orthologue:
- GDPD4
- Human Description:
- glycerophosphodiester phosphodiesterase domain containing 4 [Source:HGNC Symbol;Acc:24849]
- Mouse Orthologue:
- Gdpd4
- Mouse Description:
- glycerophosphodiester phosphodiesterase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3606573]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28972 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23223 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa28972
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111380 | Nonsense | 10 | 525 | 2 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 6411135)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 3229025 GRCz11 18 3323545 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAAGCTGGGGAAGCTAAAGGTGGTGCGGCGGCAGCTGCTGCAGCGCTA[T/G]GAGCACCAGCCATTTGTCTCCTGTCTGGCCGGTCTGTACGGCTGCCAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23223
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111380 | Essential Splice Site | 44 | 525 | 2 | 14 |
- Genomic Location (Zv9):
- Chromosome 18 (position 6411239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 3228921 GRCz11 18 3323649 - KASP Assay ID:
- 2261-1799.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGATACCAGCGCGCCAAAGCCCAGCCGGGAGAGTGCTGCTGCAGCCGGG[T/C]CAGCAAACAGACACTGATACACCAAACACTGCTTCATTCCTTCAGGGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: