zgc:193751

Ensembl ID:
ENSDARG00000078190
ZFIN IDs:
ZDB-GENE-050610-3, ZDB-GENE-080724-4
Description:
hypothetical protein LOC100170818 [Source:RefSeq peptide;Acc:NP_001124125]
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35623 Nonsense Mutation detected in F1 DNA During 2018
sa14087 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112958 Nonsense 134 802 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2920274)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2113631
GRCz11 14 2031982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCGGTCTTAGGGTTCAAGATATTAACGACAATAATCCATATTTTGGT[A/T]AAGACTTGATCAATTTGGAGATCAGTGAATCCGCCGTTAAGGGCAAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112958 Nonsense 190 802 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2920444)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2113461
GRCz11 14 2031812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAATATTTTATTTTATCCATGCAAGYAAATTCMTTTGAAGAAAAATA[T/A]GCTGAACTMGTTTTAAATAAGGAATTAGATCGMGAGMAGSAGAAAGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link