
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-39h10.1
- Ensembl ID:
- ENSDARG00000078188
- ZFIN ID:
- ZDB-GENE-070912-291
- Description:
- FTS and Hook-interacting protein homolog [Source:UniProtKB/Swiss-Prot;Acc:B0V207]
- Human Orthologue:
- FAM160A2
- Human Description:
- family with sequence similarity 160, member A2 [Source:HGNC Symbol;Acc:25378]
- Mouse Orthologue:
- Fam160a2
- Mouse Description:
- family with sequence similarity 160, member A2 Gene [Source:MGI Symbol;Acc:MGI:1921599]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa789 | Nonsense | Available for shipment | Available now |
sa21521 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa789
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110582 | Nonsense | 223 | 1124 | 4 | 12 |
- Genomic Location (Zv9):
- Chromosome 9 (position 33940589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 33096535 GRCz11 9 32907281 - KASP Assay ID:
- 554-0694.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGATCTTCTCCCTGTTGGTGCCATTTATACATCGAGACGGCGCTCTGGGG[C/T]AGCAGGCACGTGACGCACTGCTCCTYGTCATGGCAACCTCTGCCAGCAAC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa21521
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110582 | Nonsense | 870 | 1124 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 9 (position 33933020)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 33088966 GRCz11 9 32899712 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCGGGAGTCCCGGACTGCGCCTCTGCCCAGCCTGACGGATGAAGACTG[T/A]CTTCCAGTGGAGACTGAGCAGCGCTCCAGTGAAACCAAGCCTGACAGCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: