si:dkey-253e7.2

Ensembl ID:
ENSDARG00000078187
ZFIN ID:
ZDB-GENE-081105-7
Description:
Novel protein similar to vertebrate solute carrier family 12, (Potassium-chloride transporter) membe
Human Orthologue:
SLC12A5
Human Description:
solute carrier family 12 (potassium/chloride transporter), member 5 [Source:HGNC Symbol;Acc:13818]
Mouse Orthologue:
Slc12a5
Mouse Description:
solute carrier family 12, member 5 Gene [Source:MGI Symbol;Acc:MGI:1862037]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17824 Nonsense Available for shipment Available now
sa9823 Nonsense Available for shipment Available now
sa41263 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009569 Nonsense 218 1117 7 26
ENSDART00000140365 Nonsense 200 1119 6 24
Genomic Location (Zv9):
Chromosome 8 (position 38429560)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37284975
GRCz11 8 37317409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTTCTTTATTTGTAGATCTACATTGTTCCATCAGCTGCCATATTY[A/T]AAATGGAGRGTCTTGAGGGRKCAGAAGCCGAGGCAGCGCTGTTGAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009569 Nonsense 395 1117 9 26
ENSDART00000140365 Nonsense 377 1119 8 24
Genomic Location (Zv9):
Chromosome 8 (position 38425614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37281029
GRCz11 8 37313463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGGCAGTACAGGACCCTGAACTCCCAGTAACCAACAGTAACCGATA[T/A]GTGYTRGCTGATATCACCAGTTTCTTCACCCTGCTGGWWGGAATCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009569 Nonsense 688 1117 17 26
ENSDART00000140365 Nonsense 670 1119 16 24
Genomic Location (Zv9):
Chromosome 8 (position 38415820)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37271235
GRCz11 8 37303669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATCTTGCAGGCCCCAGATTTTGGTGCTCACAACTTTGGATGGAGAG[C/T]AGAACGTGGAGCAGCCTCGACTGCTGTCCCTGACCAGTCAGCTGAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link