zgc:165453

Ensembl ID:
ENSDARG00000078183
ZFIN ID:
ZDB-GENE-070720-13
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45126 Nonsense Mutation detected in F1 DNA During 2018
sa39972 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39973 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024900 Nonsense 152 1456 3 34
Genomic Location (Zv9):
Chromosome 3 (position 3988468)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3672867
GRCz11 3 3455120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGTCTTACCTGCCGCTGACCTTCATCCAGACAGACAAACCGCTCTA[C/A]AATCCAGGACAGAGGGGTGAGCTGTGAGAGCTTTATCAGAGTATTAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024900 Essential Splice Site 1178 1456 27 34
Genomic Location (Zv9):
Chromosome 3 (position 3997229)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3681628
GRCz11 3 3463881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGAGCACAGCTTTTAAATTCCTTGAGAAACACTGCCATTTCTGAAGG[T/C]AACTTATCCATAAAATTAAGTTAGACCTGTTTCTAATTGGATTTAGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024900 Essential Splice Site 1381 1456 31 34
Genomic Location (Zv9):
Chromosome 3 (position 3998495)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3682894
GRCz11 3 3465147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTGGACATCAAGCTCTTGTCAGGATTCACTGCAGACACCTCACTGG[T/C]TGGTGTGAGTTTTCAGGTTGACTTTTTGGGATGCTTGAAACTACTTGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link