zgc:175096

Ensembl ID:
ENSDARG00000078164
ZFIN ID:
ZDB-GENE-030131-1738
Description:
hypothetical protein LOC563587 [Source:RefSeq peptide;Acc:NP_001107897]
Human Orthologue:
ZNF576
Human Description:
zinc finger protein 576 [Source:HGNC Symbol;Acc:28357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36130 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105514 Essential Splice Site None 392 1 5
Genomic Location (Zv9):
Chromosome 16 (position 27402846)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25248533
GRCz11 16 25163565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGCTTATGCCTTTTCCCTCCAGACAAGAAAAGGTTATTCACTTCCAG[G/A]TAAGAATCATGTCTTATTATTTTAAAACTCAAACTAAAATAAATCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105514 Nonsense 264 392 5 5
Genomic Location (Zv9):
Chromosome 16 (position 27408071)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25253758
GRCz11 16 25168790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGAAGACGCAGAGGAAACCAATCATTCAGAGGATGCTTCTGCAACAT[C/A]GGCAAAAACAGGGGGAAGAAGAGGACGCCCTGCCAAATCCACCCAGGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link