si:dkey-56i24.1

Ensembl ID:
ENSDARG00000078152
ZFIN ID:
ZDB-GENE-081105-8
Description:
hypothetical protein LOC568129 [Source:RefSeq peptide;Acc:NP_001116761]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27238 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110897 Nonsense 268 436 1 1
ENSDART00000147822 Nonsense 268 436 2 2
Genomic Location (Zv9):
Chromosome 8 (position 33725239)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32867965
GRCz11 8 32877197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATGGTCAGTTAGTAACACTAAACGAGTGCATCTACAGGCACATGTA[T/A]CAATCCAGATATGTTCTTCTGAATGACATCGATGAGATCATCATGCCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link