wdr47

Ensembl ID:
ENSDARG00000078136
ZFIN ID:
ZDB-GENE-070216-3
Human Orthologue:
WDR47
Human Description:
WD repeat domain 47 [Source:HGNC Symbol;Acc:29141]
Mouse Orthologue:
Wdr47
Mouse Description:
WD repeat domain 47 Gene [Source:MGI Symbol;Acc:MGI:2139593]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2062 Nonsense F2 line generated During 2018
sa30602 Essential Splice Site Mutation detected in F1 DNA During 2018
sa690 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2062
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083216 Nonsense 60 902 2 14
ENSDART00000133567   None 347 None 7
ENSDART00000142251 Nonsense 60 551 3 8
Genomic Location (Zv9):
Chromosome 2 (position 45442291)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45533953
GRCz11 2 45386951
KASP Assay ID:
554-3201.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACTTTTCAATCATTCATCCCCTCTGCAGGCAGCTCATTCTGGATGGA[C/T]AGTGGGATGAAGTGTTGCAGTTTATTCAGCCTCTCGAGTGTCTGGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083216 Essential Splice Site 81 902 3 14
ENSDART00000133567   None 347 None 7
ENSDART00000142251 Essential Splice Site 81 551 4 8
Genomic Location (Zv9):
Chromosome 2 (position 45442590)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45534252
GRCz11 2 45387250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATCGGACACTCTTGGTTTAACTTCACATATATGTATGCATTTTCCA[G/T]GTTCCGTTACATTGTTTTAAAGCAGAAGTTTCTGGAAGCTTTGTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083216 Nonsense 821 902 13 14
ENSDART00000133567 Nonsense 266 347 6 7
ENSDART00000142251   None 551 None 8
Genomic Location (Zv9):
Chromosome 2 (position 45472646)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 45564308
GRCz11 2 45417306
KASP Assay ID:
554-0598.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCTGTATGCTCTATGACATTAGAGGTGGACGAATGGTTCAGACGTA[T/A]AAGCCGCACTCCAGTGACGTCCGGTCAGTGCGCTTCTCACCCGGAGCTCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link