LOC100004729

Ensembl ID:
ENSDARG00000078132
Human Orthologue:
TEX2
Human Description:
testis expressed 2 [Source:HGNC Symbol;Acc:30884]
Mouse Orthologue:
Tex2
Mouse Description:
testis expressed gene 2 Gene [Source:MGI Symbol;Acc:MGI:102465]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27938 Nonsense Mutation detected in F1 DNA During 2018
sa14815 Essential Splice Site Available for shipment Available now
sa9607 Essential Splice Site Available for shipment Available now
sa35256 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35255 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Nonsense 437 997 2 11
Genomic Location (Zv9):
Chromosome 12 (position 19536154)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18388315
GRCz11 12 18510189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGACTGTTTCTGCATTTCAGGGCTGGATGAATGAAATGTACACGTA[T/A]GATCCAGAGACCTACCAGCCGTCTCTCATGCATTCTGTACATGCCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 584 997 3 11
Genomic Location (Zv9):
Chromosome 12 (position 19535551)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18387712
GRCz11 12 18509586
KASP Assay ID:
2260-5250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGTGTCCATCCAGAATGAAGAGGACCAYTATGAATCWACAWTTGGTG[G/A]YAAAGTTGCAATCAGTTTTGACTCAAAGTCAAAGACTTRTAAGGGTCCKT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 585 997 3 11
Genomic Location (Zv9):
Chromosome 12 (position 19535550)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18387711
GRCz11 12 18509585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTCCATCCAGAATGAAGAGGACCAYTATGAATCTACATTTGGTGG[T/C]AAAGTTGCAATCAGTTTTGACTCAAAGTCAAAGACTTATAAGGGTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 788 997 7 11
Genomic Location (Zv9):
Chromosome 12 (position 19509180)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18361341
GRCz11 12 18483215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATGGAATCCTTGAGGCAGAAACAGAACTGGAGGCCTTCAGTGTGTT[G/T]TAAGTTTCTTGAAAATAAAATAGCTTCTGAATTTAGACCACAAATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112909 Essential Splice Site 945 997 11 11
Genomic Location (Zv9):
Chromosome 12 (position 19494806)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 18346967
GRCz11 12 18468841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAATTAGCCCCATAACAAATCTTCTCAAATATCCTGCTTTTTTTAT[A/G]GAATGTTTTTGTGTTGCCCAACATGGATGATATTTATCTGCCACTAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link