si:dkey-275m12.1

Ensembl ID:
ENSDARG00000078117
ZFIN ID:
ZDB-GENE-100921-4
Human Orthologue:
KALRN
Human Description:
kalirin, RhoGEF kinase [Source:HGNC Symbol;Acc:4814]
Mouse Orthologue:
Kalrn
Mouse Description:
kalirin, RhoGEF kinase Gene [Source:MGI Symbol;Acc:MGI:2685385]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21425 Nonsense Available for shipment Available now
sa18651 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa21425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114042 Nonsense 379 1505 6 30
ENSDART00000136129   None 1612 None 37
Genomic Location (Zv9):
Chromosome 9 (position 4259632)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4308554
GRCz11 9 4277063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGCCACTACGCCGCTCAGCAGATCAAACAGATCAGCACTCAGCTGGAT[C/T]AGGAGTGGAAGAGCTTCGCGGCTGCTCTCGATGAACGCAGCACCATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114042 Essential Splice Site 910 1505 None 30
ENSDART00000136129 Missense 105 1612 3 37
Genomic Location (Zv9):
Chromosome 9 (position 4305839)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4354565
GRCz11 9 4323074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCTTCNTTTTCTCTTYCTGCAGTCTTTGTTCCACGCTAACTCTCTCC[A/T]GAAAACCCATCAGAGTGCACTACAGGTCCAGCAGAAGGCAGAAATCATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link