
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-150i13.1
- Ensembl ID:
- ENSDARG00000078102
- ZFIN ID:
- ZDB-GENE-090313-44
- Description:
- Novel protein similar to vertebrate pleckstrin and Sec7 domain containing (PSD) [Source:UniProtKB/Tr
- Human Orthologue:
- PSD
- Human Description:
- pleckstrin and Sec7 domain containing [Source:HGNC Symbol;Acc:9507]
- Mouse Orthologue:
- Psd
- Mouse Description:
- pleckstrin and Sec7 domain containing Gene [Source:MGI Symbol;Acc:MGI:1920978]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8714 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa35474 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8714
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112900 | Nonsense | 109 | 1603 | 1 | 16 |
ENSDART00000140151 | None | 504 | None | 12 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22921204)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22650542 GRCz11 13 22780992 - KASP Assay ID:
- 2260-6340.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGACTCTGACCAATCGACAACCCAGCACCAAAAAAACCTACCTTATGAT[G/T]AGATAAGYCARTTACTCTCTGTCCTCCAAACAGGAACCACTGGAAACAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35474
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112900 | Essential Splice Site | 1093 | 1603 | 5 | 16 |
ENSDART00000140151 | None | 504 | None | 12 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22906679)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22636017 GRCz11 13 22766467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTCATTTACTAGCATTCAGATTATTCTTATTTTTAATTTTTTTGTTTCC[A/T]GAGAGAGGCCATCACGACCAGTGTCTGAGTCTGATCCAGAGGTAGCTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: