zgc:172065

Ensembl ID:
ENSDARG00000078093
ZFIN ID:
ZDB-GENE-080214-2
Description:
hypothetical protein LOC100137122 [Source:RefSeq peptide;Acc:NP_001108191]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12902 Nonsense Available for shipment Available now
sa9649 Nonsense Available for shipment Available now
sa26865 Nonsense Mutation detected in F1 DNA During 2018
sa10034 Nonsense Available for shipment Available now
sa40822 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064292 Nonsense 39 496 2 2
ENSDART00000075859 Nonsense 40 498 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2855710)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2431767
GRCz11 7 2239829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGTMTACAAAYAGAGAGGAAAYTGCTTGATGAAAATGAAAAAGTCAGG[A/T]AATGGACCTTTGGCACWAGAGATGSCAGTAAACCACAYAAAATCTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064292 Nonsense 83 496 2 2
ENSDART00000075859 Nonsense 84 498 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2855842)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2431899
GRCz11 7 2239961
KASP Assay ID:
2259-8349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCATCAACACCAYGGTCAACTAYCTAATGGGAGTGAAGTTTGAGGAA[G/T]AAACTTGGTATGAAATYACAGAAGAAGCAGTCAGAGATCAGTCAGAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064292 Nonsense 130 496 2 2
ENSDART00000075859 Nonsense 131 498 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2855983)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2432040
GRCz11 7 2240102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTCCATTTCTCTCACCATCATTGATACTCCAGGTTACGGAGACACT[A/T]GAGGACTGGAGAAAGATCTGGAAGTTGCAGAGAATTTATCTGCTCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064292 Nonsense 239 496 2 2
ENSDART00000075859 Nonsense 240 498 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2856310)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2432367
GRCz11 7 2240429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGTGGCCAACCTGTTCAYTTCCAATTYAACAATCGTCAAGCTGAACCT[C/T]GWCAAACTAAAGAACGYTACATTYGTGCTCAAAGAGATGCTTGGGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064292 Nonsense 449 496 2 2
ENSDART00000075859 Nonsense 450 498 2 2
Genomic Location (Zv9):
Chromosome 7 (position 2856940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 2432997
GRCz11 7 2241059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAGTTTTAATGGAAGATCTTGAAGAAGAGCTGAAGGAGATTGATGAA[C/T]AAAAAGCAGATCTTATTGTCAGTGCCTACCACAACATCAAGCATCTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link