si:dkeyp-22h2.1

Ensembl ID:
ENSDARG00000078087
ZFIN ID:
ZDB-GENE-090312-51
Description:
Novel protein similar to H.sapiens CNNM2, cyclin M2 (CNNM2) [Source:UniProtKB/TrEMBL;Acc:B8A687]
Human Orthologue:
CNNM1
Human Description:
cyclin M1 [Source:HGNC Symbol;Acc:102]
Mouse Orthologue:
Cnnm1
Mouse Description:
cyclin M1 Gene [Source:MGI Symbol;Acc:MGI:1891366]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13084 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112646 Nonsense 243 437 1 4
Genomic Location (Zv9):
Chromosome 13 (position 41105800)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40371863
GRCz11 13 40497753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCCAGTGTTTGAGAACGAAAGATCCAATATTGTTGATATTCTGTTCGTC[A/T]AAGATCTGGCTTTTGTTGACCCAGATGACTGCACGCCGTTAAAAACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link