
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:103688
- Ensembl ID:
- ENSDARG00000078085
- ZFIN ID:
- ZDB-GENE-040912-105
- Description:
- small nuclear ribonucleoprotein polypeptide G isoform 1 [Source:RefSeq peptide;Acc:NP_001161373]
- Human Orthologue:
- SNRPG
- Human Description:
- small nuclear ribonucleoprotein polypeptide G [Source:HGNC Symbol;Acc:11163]
- Mouse Orthologue:
- Snrpg
- Mouse Description:
- small nuclear ribonucleoprotein polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1915261]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18592 | Essential Splice Site | Available for shipment | Available now |
sa14217 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18592
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108986 | Essential Splice Site | 11 | 76 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34269028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34030976 GRCz11 23 33957507 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATCTYACTAAATAAACATGAGCAAAGCACATCCACCCGAGCTGAAAAAG[T/G]AAGTATTTCAAGTATTTTCTTGAGTCTTTTAGAAATTTGATATTAAGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14217
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108986 | Nonsense | 75 | 76 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34273269)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34035216 GRCz11 23 33961747 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YTTTTCAGGTAATCAGAGGAAACAGTATCATCAWGCTGGAGGCTCTTGAR[C/T]GAGTATGAGAAAGACACCCAGNNTTTTTTTCCCCCCTCTTTTTGTTATTTTN
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: