zgc:103688

Ensembl ID:
ENSDARG00000078085
ZFIN ID:
ZDB-GENE-040912-105
Description:
small nuclear ribonucleoprotein polypeptide G isoform 1 [Source:RefSeq peptide;Acc:NP_001161373]
Human Orthologue:
SNRPG
Human Description:
small nuclear ribonucleoprotein polypeptide G [Source:HGNC Symbol;Acc:11163]
Mouse Orthologue:
Snrpg
Mouse Description:
small nuclear ribonucleoprotein polypeptide G Gene [Source:MGI Symbol;Acc:MGI:1915261]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18592 Essential Splice Site Available for shipment Available now
sa14217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108986 Essential Splice Site 11 76 1 4
Genomic Location (Zv9):
Chromosome 23 (position 34269028)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34030976
GRCz11 23 33957507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTYACTAAATAAACATGAGCAAAGCACATCCACCCGAGCTGAAAAAG[T/G]AAGTATTTCAAGTATTTTCTTGAGTCTTTTAGAAATTTGATATTAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108986 Nonsense 75 76 4 4
Genomic Location (Zv9):
Chromosome 23 (position 34273269)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34035216
GRCz11 23 33961747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTTTCAGGTAATCAGAGGAAACAGTATCATCAWGCTGGAGGCTCTTGAR[C/T]GAGTATGAGAAAGACACCCAGNNTTTTTTTCCCCCCTCTTTTTGTTATTTTN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link