
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ARMC5
- Ensembl ID:
- ENSDARG00000078083
- Description:
- armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
- Human Orthologue:
- ARMC5
- Human Description:
- armadillo repeat containing 5 [Source:HGNC Symbol;Acc:25781]
- Mouse Orthologue:
- Armc5
- Mouse Description:
- armadillo repeat containing 5 Gene [Source:MGI Symbol;Acc:MGI:2384586]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33201 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33200 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12239 | Nonsense | Available for shipment | Available now |
sa15905 | Nonsense | Available for shipment | Available now |
sa824 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa33201
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112266 | Nonsense | 19 | 673 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 31208360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 30926399 GRCz11 3 31057241 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTCCAGGAAGTTTGTGGACCTGGCACTGAGCATCTTGGCCAACTGCTG[C/A]ACTGAAAAGGGGACCAGACTACAAGTGAGGAAATATTCATTATAGTAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33200
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112266 | Nonsense | 160 | 673 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 31204076)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 30922115 GRCz11 3 31052957 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAGGCTGCAGTGCGGAGTGTGCCAGAGAGATGTCCCGCTCTGGGGCTT[T/A]GACTCAGCTCGGGGTTCTGGCTTCGGGAGAAGACGGTCGGCCTTTGGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12239
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112266 | Nonsense | 330 | 673 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 31201730)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 30919769 GRCz11 3 31050611 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTGTTTGTTGCTCATTTTCATGTGTGTGTTTTCGTSCCTCCAGGTCTTG[G/A]CTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGTKAGCTGACTGAATGCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15905
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112266 | Nonsense | 342 | 673 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 31201696)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 30919735 GRCz11 3 31050577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTSCCTCCAGGTCTTGRCTGGTGTCGGAGGGTCTGATCTCGTCTGAGGGT[G/T]AGCTGACTGAATGCCCGAGCGGRCCTGATGTGTTTGGTGGCAGCCCTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa824
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112266 | Essential Splice Site | 484 | 673 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 31200915)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 30918954 GRCz11 3 31049796 - KASP Assay ID:
- 554-0728.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGAACAGACAGACAGTCTGAAAAAGTCAAAGGGAAAATCACGCAGCTAG[G/A]TTTGTGACTTTAGTATTCATTGGGATATAAATAATAGGGTATATGCCGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: