si:dkey-46d17.3

Ensembl ID:
ENSDARG00000078078
ZFIN ID:
ZDB-GENE-070705-473
Description:
Novel protein similar to vertebrate leucine rich repeat and fibronectin type III domain containing 2
Human Orthologue:
LRFN4
Human Description:
leucine rich repeat and fibronectin type III domain containing 4 [Source:HGNC Symbol;Acc:28456]
Mouse Orthologue:
Lrfn4
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:238

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41059 Nonsense Mutation detected in F1 DNA During 2018
sa12260 Nonsense Available for shipment Available now
sa17394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109404 Nonsense 46 588 1 2
ENSDART00000148038 Nonsense 128 914 2 3
Genomic Location (Zv9):
Chromosome 7 (position 61061663)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60280628
GRCz11 7 60585865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTCTGCATGCCCCTTTCACTGTGTCTGCAGAAATCTCTCTGAGTCTT[T/A]AAGTACGCTTTGTGCAGATAAAGGCCTTCTTTTTGTTCCACCAAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109404 Nonsense 479 588 1 2
ENSDART00000148038 Nonsense 561 914 2 3
Genomic Location (Zv9):
Chromosome 7 (position 61062963)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60281928
GRCz11 7 60587165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAAGTGAGATGGGATAAGGGTCATCTTATGGCAGCCAACCTGGTGTG[G/A]ATGTATCAAATACAGTACAACTGCACTGYCGATGAGACACTTGTTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109404   None 588 None 2
ENSDART00000148038 Nonsense 688 914 3 3
Genomic Location (Zv9):
Chromosome 7 (position 61073431)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60292396
GRCz11 7 60597633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCAACCAKGACARWCATCATGAAATAGGCGAAGAGGTCGGATGCTCA[G/T]GAACAGACTCACCGCCTCTTCCTTCAAAGGGAGCMRATGTCTTTTCWCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link