zgc:165617

Ensembl ID:
ENSDARG00000078061
ZFIN ID:
ZDB-GENE-070615-37
Description:
hypothetical protein LOC561095 [Source:RefSeq peptide;Acc:NP_001092209]
Human Orthologue:
BAZ2B
Human Description:
bromodomain adjacent to zinc finger domain, 2B [Source:HGNC Symbol;Acc:963]
Mouse Orthologue:
Baz2b
Mouse Description:
bromodomain adjacent to zinc finger domain, 2B Gene [Source:MGI Symbol;Acc:MGI:2442782]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40646 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109552 Nonsense 164 445 4 8
Genomic Location (Zv9):
Chromosome 6 (position 11905650)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11759276
GRCz11 6 11994703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTGTTCCAGGGGAGAGGAAGAGATTGCTCCAGGAATGAAGCTCTG[G/A]CGGAAAGCTTTGAGTGAGGTGCGCAGCTCCTCTCAGCTGGCCATGTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: Identification of a sudden cardiac death susceptibility locus at 2q24.2 through genome-wide association in European ancestry individuals. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link