zgc:171223

Ensembl ID:
ENSDARG00000078054
ZFIN ID:
ZDB-GENE-070928-7
Description:
Protein Spindly [Source:UniProtKB/Swiss-Prot;Acc:A7MD70]
Human Orthologue:
CCDC99
Human Description:
coiled-coil domain containing 99 [Source:HGNC Symbol;Acc:26010]
Mouse Orthologue:
Ccdc99
Mouse Description:
coiled-coil domain containing 99 Gene [Source:MGI Symbol;Acc:MGI:1917635]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35739 Nonsense Mutation detected in F1 DNA During 2018
sa32001 Nonsense Available for shipment Available now
sa32000 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113900 Nonsense 255 590 6 12
ENSDART00000114970 Nonsense 255 590 6 12
Genomic Location (Zv9):
Chromosome 14 (position 40315831)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38479065
GRCz11 14 38819379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATCCAGCTGGAGCAGGTGTTGCAGCAGGCACAAGATCCAAACAGC[A/T]AAGGCAATTCCTTGTTTTCTGAGGTACAGCATTACTTCTACTTTTTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113900 Nonsense 475 590 11 12
ENSDART00000114970   None 590 None 12
Genomic Location (Zv9):
Chromosome 14 (position 40311859)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38475093
GRCz11 14 38815407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTTCCAGAAGAAAACTCTGCATCTGTAAAAGACGAAACCACAACC[C/T]AGGATACCGAGCCAAGCAAGAACTCGAACGAAAAAGCAGAAGAAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113900   None 590 None 12
ENSDART00000114970 Nonsense 475 590 11 12
Genomic Location (Zv9):
Chromosome 14 (position 40212155)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 38475093
GRCz11 14 38815407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTTCCAGAAGAAAACTCTGCATCTGTAAAAGACGAAACCACAACC[C/T]AGGATACCGAGCCAAGCAAGAACTCGAATGAAAAAGCAGAAGAAAAAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link