
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zcchc24
- Ensembl ID:
- ENSDARG00000078026
- ZFIN ID:
- ZDB-GENE-030131-3573
- Description:
- zinc finger CCHC domain-containing protein 24 [Source:RefSeq peptide;Acc:NP_001091858]
- Human Orthologue:
- ZCCHC24
- Human Description:
- zinc finger, CCHC domain containing 24 [Source:HGNC Symbol;Acc:26911]
- Mouse Orthologue:
- Zcchc24
- Mouse Description:
- zinc finger, CCHC domain containing 24 Gene [Source:MGI Symbol;Acc:MGI:1919168]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35515 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35515
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109307 | Nonsense | 14 | 238 | 1 | 4 |
The following transcripts of ENSDARG00000078026 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 30869287)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 30515235 GRCz11 13 30645685 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTAACAACATGAGCTTGTTGTCTGCTATAGACACCAGTACCTCAGTGTA[C/A]CAGCCTGCACAGCTTCTCAACTGGGTTTACCTTTCTTTACAAGACACGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: