zgc:163052

Ensembl ID:
ENSDARG00000078016
ZFIN ID:
ZDB-GENE-070410-129
Description:
Novel protein similar to H.sapiens DTX4, deltex 4 homolog (Drosophila) (DTX4, zgc:163052) [Source:Un
Human Orthologue:
DTX4
Human Description:
deltex homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:29151]
Mouse Orthologue:
Dtx4
Mouse Description:
deltex 4 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2672905]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32727 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114230 Nonsense 107 731 3 9
ENSDART00000146310   None 93 None 2
Genomic Location (Zv9):
Chromosome 1 (position 41894105)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40810057
GRCz11 1 41512844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGCTGGATATGGGAGTGGGAAAATGACACCGGATCCTGGATAACTTA[T/A]GACATGGAGGTGAGCATTGCATTGCAAGCAGCATGGGACCGACACCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link