WDR1

Ensembl ID:
ENSDARG00000077991
Description:
WD repeat domain 1 [Source:HGNC Symbol;Acc:12754]
Human Orthologue:
WDR1
Human Description:
WD repeat domain 1 [Source:HGNC Symbol;Acc:12754]
Mouse Orthologue:
Wdr1
Mouse Description:
WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12687 Nonsense Available for shipment Available now
sa22400 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111971 Nonsense 141 606 5 24
Genomic Location (Zv9):
Chromosome 14 (position 278342)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 304360
GRCz11 14 168394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCAGGTTTGGTGCAGTGTTCCTCTGGGACACCGGTTCTTCAGTGGGG[G/T]AGATTGTGGGTYAMAGTAAGATCATCAACAGTGTGGACATCAAGCAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111971 Splice Site, Nonsense 209 606 8 24
Genomic Location (Zv9):
Chromosome 14 (position 278630)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 304648
GRCz11 14 168682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATTGTACATGATATACTCAACATTTAGTACAAGTGATGCCATGAACA[G/T]AGCCAATGCTGCTGAGACGCCATCAAAACACAGAGAAATACAGTAATGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiovascular disease risk factors: Genetic variants in LPL, OASL and TOMM40/APOE-C1-C2-C4 genes are associated with multiple cardiovascular-related traits. (View Study)
  • Urate levels: Genome-wide association study identifies genes for biomarkers of cardiovascular disease: serum urate and dyslipidemia. (View Study)
  • Uric acid levels: A genome-wide association study of serum uric acid in African Americans. (View Study)
  • Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link