zfat

Ensembl ID:
ENSDARG00000077987
Human Orthologue:
ZFAT
Human Description:
zinc finger and AT hook domain containing [Source:HGNC Symbol;Acc:19899]
Mouse Orthologue:
Zfat
Mouse Description:
zinc finger and AT hook domain containing Gene [Source:MGI Symbol;Acc:MGI:2681865]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36134 Nonsense Available for shipment Available now
sa36135 Nonsense Mutation detected in F1 DNA During 2018
sa22840 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109710 Nonsense 336 1181 6 16
Genomic Location (Zv9):
Chromosome 16 (position 27587180)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25432867
GRCz11 16 25347899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCACATGCGCAAACACACCGGAGAGAAGTTCAGCTGCGACCTCTGCT[C/A]GTTTAACTGCCTCAGTAGAGGACACCTCAAAGTGCACGTAGAGCGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109710 Nonsense 654 1181 6 16
Genomic Location (Zv9):
Chromosome 16 (position 27588133)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25433820
GRCz11 16 25348852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTAATGCAGAACTACACATTTCAGAGCAAGAGGAAATATCTGCTTTC[A/T]AACAGATCCTAGAACAGATGCAGAAACGACAGCTTAACATGGAAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109710 Essential Splice Site 763 1181 7 16
Genomic Location (Zv9):
Chromosome 16 (position 27588757)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25434444
GRCz11 16 25349476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGATAAATACAAGCTTCAGGCTCATCTCAAAACCCACTCGGACATAG[T/A]GAGTTTTGAAGACTATATTTATTCTGGAAATATTGGCAAAATGTCTTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Hypertension: Two-marker association tests yield new disease associations for coronary artery disease and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link