si:dkey-273e13.4

Ensembl ID:
ENSDARG00000077977
ZFIN ID:
ZDB-GENE-090313-294
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JJR2]
Human Orthologue:
WDR27
Human Description:
WD repeat domain 27 [Source:HGNC Symbol;Acc:21248]
Mouse Orthologue:
Wdr27
Mouse Description:
WD repeat domain 27 Gene [Source:MGI Symbol;Acc:MGI:1918932]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16311 Nonsense Available for shipment Available now
sa16763 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108635 Nonsense 49 161 3 6
ENSDART00000141379 Nonsense 107 170 3 5
Genomic Location (Zv9):
Chromosome 13 (position 35777042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35429618
GRCz11 13 35555450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATATGAACCGTGGGAGTTTAGTCACACAGATTCCAGATGCCCACTGT[C/T]GAGCTGTCCACCACCTCGCCCAGAATCAGGTAGGAGTTATTAGCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108635 Nonsense 65 161 4 6
ENSDART00000141379 Nonsense 123 170 4 5
Genomic Location (Zv9):
Chromosome 13 (position 35784189)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35436765
GRCz11 13 35562597
KASP Assay ID:
2260-6719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAATATATTCTGTTTTATTTTTAYTGCAGGGATCTTCATTCTGTACA[C/T]AAGCTGTGCAAGCATACAATCTCTTCCTGAGCRGTGCTTTAACGGATGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link