zgc:56292

Ensembl ID:
ENSDARG00000077953
ZFIN ID:
ZDB-GENE-040426-969
Description:
hypothetical protein LOC393193 [Source:RefSeq peptide;Acc:NP_956518]
Human Orthologue:
TRIP10
Human Description:
thyroid hormone receptor interactor 10 [Source:HGNC Symbol;Acc:12304]
Mouse Orthologue:
Trip10
Mouse Description:
thyroid hormone receptor interactor 10 Gene [Source:MGI Symbol;Acc:MGI:2146901]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39729 Nonsense Mutation detected in F1 DNA During 2018
sa32810 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055107 Nonsense 141 359 6 11
Genomic Location (Zv9):
Chromosome 1 (position 59773598)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 58234133
GRCz11 1 58931136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATTGGCTGATTGATTGATTGATTTGTAACCAGAGTAAAAGGCGTTTC[G/T]AGAAGGAGTGGAAAGAAGCAGAAAAGGCCAATCAGCAAACAGAGAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055107 Nonsense 271 359 9 11
Genomic Location (Zv9):
Chromosome 1 (position 59775788)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150611.1 1191
GRCz11 1 58933326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGTAATCTGCTCTGTGCGCAGGACACTCTGGCCCTCATCGAGCAGTA[C/A]AAGTCAGGTGCGGTTCCTCCTGCTGATGTGGAGTTTGAGGATTTCAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link