smarcc2

Ensembl ID:
ENSDARG00000077946
Human Orthologue:
SMARCC2
Human Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 [S
Mouse Orthologue:
Smarcc2
Mouse Description:
SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 Ge

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40752 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30875 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14964 Nonsense Available for shipment Available now
sa33917 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112637 Essential Splice Site 38 1036 2 26
ENSDART00000112637 Essential Splice Site 38 1036 2 26
Genomic Location (Zv9):
Chromosome 6 (position 39770177)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39841777
GRCz11 6 39839313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATTTTATTATGAGATCAAGCCCCTTCACCTTCTCTATCTTTTCCCA[G/A]TATATTCAAGCAGAGCCCCCCACCAATAAATCTTTGTCGAGTCTGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112637 Essential Splice Site 38 1036 2 26
ENSDART00000112637 Essential Splice Site 38 1036 2 26
Genomic Location (Zv9):
Chromosome 6 (position 39770177)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39841777
GRCz11 6 39839313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAATTTTATTATGAGATCAAGCCCCTTCACCTTCTCTATCTTTTCCCA[G/A]TATATTCAAGCAGAGCCCCCCACCAATAAATCTTTGTCGAGTCTGGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112637 Nonsense 328 1036 10 26
Genomic Location (Zv9):
Chromosome 6 (position 39775247)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39846847
GRCz11 6 39844383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAANGCTTNNTGTGTTTTCAGTCCCACTACTCCCTACACTAAATCCAAA[C/T]GAGGACAGAGAGAAGAAGAGCAAGAAGATCTGACTAAAGAGTTGGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112637 Essential Splice Site 1014 1036 25 26
Genomic Location (Zv9):
Chromosome 6 (position 39793046)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39864646
GRCz11 6 39862182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTCACAGTTCACCTCCTAACAACACACAGGCTGGAGCAGCACATG[G/A]TAAGAGCATACAAAAAACAGAGAAACTACTGCTTATAAATACTGTACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link