
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:194678
- Ensembl ID:
- ENSDARG00000077940
- ZFIN IDs:
- ZDB-GENE-030131-8082, ZDB-GENE-030131-8082
- Description:
- V-set and transmembrane domain-containing protein 2B [Source:RefSeq peptide;Acc:NP_001122250]
- Human Orthologue:
- VSTM2B
- Human Description:
- V-set and transmembrane domain containing 2B [Source:HGNC Symbol;Acc:33595]
- Mouse Orthologue:
- Vstm2b
- Mouse Description:
- V-set and transmembrane domain containing 2B Gene [Source:MGI Symbol;Acc:MGI:1914525]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21052 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21052
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110590 | Essential Splice Site | 231 | 260 | 4 | 5 |
ENSDART00000124876 | Essential Splice Site | 231 | 260 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 7 (position 46060879)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 44733707 GRCz11 7 45072932 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCGCCTCGGCCAGGCAATTCATCTATCCTGAGACAACAGCACGGATCCG[G/C]TGAGTGACAGTGCAACAGCGACACCGAGCGGTCGAGAGAGGAACATTTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Diabetic retinopathy : Genome-wide meta-analysis for severe diabetic retinopathy. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: