zgc:194551

Ensembl ID:
ENSDARG00000077903
ZFIN ID:
ZDB-GENE-030131-4878
Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 2-like [Source:RefSeq peptide;Acc:NP_001122268]
Human Orthologues:
B3GALNT1, B3GALT5
Human Descriptions:
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) [Source:HGNC Symbol;Acc:918]
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:920]
Mouse Orthologues:
B3galnt1, B3galt5
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:213
UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18188 Essential Splice Site Available for shipment Available now
sa15397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110293 Essential Splice Site 23 362 1 2
Genomic Location (Zv9):
Chromosome 22 (position 27161309)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26664254
GRCz11 22 26495301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGAGCTACCGGACAAACTGGTAACAGCGGGAAAGCCRTTCTTACGGAGG[T/A]AAGTGGACAGCTGGTRAGCGCAAAAAGGAACRGCATCATACTGCCTCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110293 Nonsense 85 362 2 2
Genomic Location (Zv9):
Chromosome 22 (position 27170866)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26654697
GRCz11 22 26484072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACAAAGACCAAACGCAGACTCTCCAAACACTGAAGAAGATCCWGGGT[T/A]GTACCATGTTGCCTACCCTCGAAATTACAAATTCATCATARACCAACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link