zgc:162965

Ensembl ID:
ENSDARG00000077883
ZFIN ID:
ZDB-GENE-041111-264
Description:
Protein FAM83D [Source:UniProtKB/Swiss-Prot;Acc:A4QP72]
Human Orthologue:
FAM83D
Human Description:
family with sequence similarity 83, member D [Source:HGNC Symbol;Acc:16122]
Mouse Orthologue:
Fam83d
Mouse Description:
family with sequence similarity 83, member D Gene [Source:MGI Symbol;Acc:MGI:1919128]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11577 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112209 Nonsense 108 534 1 4
ENSDART00000124864 Nonsense 120 546 2 5
ENSDART00000141478   None 95 None 2
Genomic Location (Zv9):
Chromosome 11 (position 26262191)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25091016
GRCz11 11 25328632
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACCCTGGACTGCTCATCTGTCACTTACTTCCCGGAGGTCTCTGACATT[G/T]AGCCCCCGGTGCTGGARAACGGCTGGCCGGCGTTCACTRCAGGCTCGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link