
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:162965
- Ensembl ID:
- ENSDARG00000077883
- ZFIN ID:
- ZDB-GENE-041111-264
- Description:
- Protein FAM83D [Source:UniProtKB/Swiss-Prot;Acc:A4QP72]
- Human Orthologue:
- FAM83D
- Human Description:
- family with sequence similarity 83, member D [Source:HGNC Symbol;Acc:16122]
- Mouse Orthologue:
- Fam83d
- Mouse Description:
- family with sequence similarity 83, member D Gene [Source:MGI Symbol;Acc:MGI:1919128]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11577 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11577
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112209 | Nonsense | 108 | 534 | 1 | 4 |
ENSDART00000124864 | Nonsense | 120 | 546 | 2 | 5 |
ENSDART00000141478 | None | 95 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 26262191)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 25091016 GRCz11 11 25328632 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCACCCTGGACTGCTCATCTGTCACTTACTTCCCGGAGGTCTCTGACATT[G/T]AGCCCCCGGTGCTGGARAACGGCTGGCCGGCGTTCACTRCAGGCTCGTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: