slc2a5

Ensembl ID:
ENSDARG00000077875
ZFIN ID:
ZDB-GENE-060222-2
Description:
solute carrier family 2 (facilitated glucose/fructose transporter), member 5 (slc2a5), non-coding RN
Human Orthologues:
SLC2A5, SLC2A7
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 7 [Source:HGNC Symbol;Acc:13445]
solute carrier family 2 (facilitated glucose/fructose transporter), member 5 [Source:HGNC Symbol;Acc
Mouse Orthologues:
Slc2a5, Slc2a7
Mouse Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17490 Essential Splice Site Available for shipment Available now
sa43974 Nonsense Mutation detected in F1 DNA During 2018
sa43975 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1330 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112141 Essential Splice Site 101 479 None 14
ENSDART00000147087 Essential Splice Site 100 511 None 12
Genomic Location (Zv9):
Chromosome 23 (position 22911441)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22690748
GRCz11 23 22617299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWTTGCATTAAATTCCAATTTTTATTCCCCCTATTTGTTGATTGGYTTAC[A/T]GAAAAGGCACACTCCTGTTCAATAACATCTTCTCTATTGTTCCCGCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112141 Nonsense 184 479 5 14
ENSDART00000147087 Nonsense 189 511 5 12
Genomic Location (Zv9):
Chromosome 23 (position 22911854)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22691161
GRCz11 23 22617712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCGTTGGCATTCTTGTCGCCCAGATATTTGGAATTCGTAGTATCCTT[G/T]GAAATAAAGAAGGTAATTTGTGTAAAGTGCATGGGATTTTTGTACATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112141 Essential Splice Site 188 479 6 14
ENSDART00000147087   None 511 None 12
Genomic Location (Zv9):
Chromosome 23 (position 22911901)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22691208
GRCz11 23 22617759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAAATAAAGAAGGTAATTTGTGTAAAGTGCATGGGATTTTTGTACA[T/C]TTTTTGAGGCAATAGTGCAAATAAGTTTGATGCAAAACTCTAACAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112141 Essential Splice Site 431 479 13 14
ENSDART00000147087 Essential Splice Site 436 511 11 12
Genomic Location (Zv9):
Chromosome 23 (position 22924071)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22703378
GRCz11 23 22629929
KASP Assay ID:
554-1244.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATTGGCTATCTAACTTCACAGTCGGCCTGGTCTTCCCTTTTCTAGAG[G/A]TCAGAGGTCATAGTTTATATATATTTCAGCCGAATTTGNAAAAAAAANNT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link