si:dkey-265k11.2

Ensembl ID:
ENSDARG00000077874
ZFIN ID:
ZDB-GENE-090313-291
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4S0]
Human Orthologue:
C6orf27
Human Description:
chromosome 6 open reading frame 27 [Source:HGNC Symbol;Acc:13939]
Mouse Orthologue:
D17H6S56E-3
Mouse Description:
DNA segment, Chr 17, human D6S56E 3 Gene [Source:MGI Symbol;Acc:MGI:1306798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32724 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110014 Essential Splice Site 161 237 2 4
ENSDART00000136462 Essential Splice Site 161 172 2 3
ENSDART00000136916   None 172 None 2
Genomic Location (Zv9):
Chromosome 1 (position 40685425)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39574834
GRCz11 1 40292907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTGGCTGCCCGCACCAGCCTGGGGACTGTATGCCACACTTTACAGG[T/G]AAGTTGGTCATGAAGAACATACTTATGCTGGCCTCATACAATGAAAATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link