zgc:194177

Ensembl ID:
ENSDARG00000077863
ZFIN ID:
ZDB-GENE-081022-70
Description:
hypothetical protein LOC796066 [Source:RefSeq peptide;Acc:NP_001170931]
Human Orthologue:
C16orf68
Human Description:
chromosome 16 open reading frame 68 [Source:HGNC Symbol;Acc:28368]
Mouse Orthologue:
BC024814
Mouse Description:
cDNA sequence BC024814 Gene [Source:MGI Symbol;Acc:MGI:2384301]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12609 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115370 Essential Splice Site 227 357 7 11
ENSDART00000125330 Essential Splice Site 274 403 9 13
Genomic Location (Zv9):
Chromosome 3 (position 28042426)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27760465
GRCz11 3 27891307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGATCATGGTRCGTCAGCTGGACTGGATGGCGGACGATTTCTGCACWG[G/A]TAAGAAATYGAGGGGATACTGGTGTGATTTGCTAATTGGTGTAAATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link