si:ch211-67f24.5

Ensembl ID:
ENSDARG00000077850
ZFIN ID:
ZDB-GENE-030131-7667
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A6D6]
Human Orthologue:
LGALS3
Human Description:
lectin, galactoside-binding, soluble, 3 [Source:HGNC Symbol;Acc:6563]
Mouse Orthologue:
Lgals3
Mouse Description:
lectin, galactose binding, soluble 3 Gene [Source:MGI Symbol;Acc:MGI:96778]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44794 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113204 Nonsense 27 368 2 5
ENSDART00000137335 Missense 16 251 3 4
ENSDART00000146671   None 202 None 4

The following transcripts of ENSDARG00000077850 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 36981373)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36453675
GRCz11 13 36579507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGATGATGTTCCTAGTGAAGCATCAAAAAATAAGCACACCAATCCAT[C/A]AGCTCCTGGAAATGGAGCTCCCCCACCCACTAATCCTGGCTGGCCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link