wu:fj66b05

Ensembl ID:
ENSDARG00000077842
ZFIN ID:
ZDB-GENE-030131-9341
Human Orthologue:
JUB
Human Description:
jub, ajuba homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:20250]
Mouse Orthologue:
Jub
Mouse Description:
ajuba Gene [Source:MGI Symbol;Acc:MGI:1341886]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31568 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111923 Nonsense 119 688 1 8
Genomic Location (Zv9):
Chromosome 7 (position 25277986)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23839738
GRCz11 7 24110895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCATCCATCGACTCTTGCCCCTCTGCGGCGCCGGTCGCCCCAGCAG[C/T]GAGCATCATGCTACCTACCTGATACGTTGGAGGGCCGTGGTACCTGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link