si:dkey-34f9.3

Ensembl ID:
ENSDARG00000077813
ZFIN ID:
ZDB-GENE-081104-410
Description:
Novel protein similar to vertebrate pancreas specific transcription factor, 1a (PTF1A) [Source:UniPr
Human Orthologue:
PTF1A
Human Description:
pancreas specific transcription factor, 1a [Source:HGNC Symbol;Acc:23734]
Mouse Orthologue:
Ptf1a
Mouse Description:
pancreas specific transcription factor, 1a Gene [Source:MGI Symbol;Acc:MGI:1328312]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21596 Nonsense Available for shipment Available now
sa38762 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113597 Nonsense 173 207 1 2
ENSDART00000135202 Nonsense 128 162 1 2
Genomic Location (Zv9):
Chromosome 9 (position 46858507)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45989787
GRCz11 9 45790266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTTACATCGCCCTGCTCAGGGAAATCCTCCTATCAGGCTGTGACCCC[A/T]AATCATATGTGGACGAATGCATGAAGAACGGCTATAAGAATCAGACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113597 Essential Splice Site 195 207 1 2
ENSDART00000135202 Essential Splice Site 150 162 1 2
Genomic Location (Zv9):
Chromosome 9 (position 46858577)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45989857
GRCz11 9 45790336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAGAACGGCTATAAGAATCAGACAAATGCCATCTGGAACACAAGCG[G/A]TAAATATTTGTGCAATATACAGGCTGAGACTATTATATGTGAAGAGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link